OPEN ACCESS | RESEARCH NOTES                                               ISSN: 2576-828X

 

"Special Issue on Epilepsy & Comorbidities"

Pathogenic mutations in ARX, CDKL5 and STXBP1 genes are not associated with the early-onset epileptic encephalopathy in Malaysian pediatric patients: A pilot study

Ameerah Jaafar 1,2, Feizel Alsiddiq 1 and King-Hwa Ling 2,3,*

 

1 Department of Paediatrics, Faculty of Medicine and Health Sciences, Universiti Putra Malaysia, 43400 UPM Serdang, Selangor, Malaysia.

2 Neurobiology and Genetics Group, Department of Biomedical Sciences, Faculty of Medicine and Health Sciences, Universiti Putra Malaysia, 43400 UPM Serdang, Selangor, Malaysia.

3 Genetics and Regenerative Medicine Research Centre, Faculty of Medicine and Health Science, Universiti Putra Malaysia, 43400 UPM Serdang, Selangor, Malaysia.

* Correspondence: lkh@upm.edu.my; Tel.: +603-89472564

 

Received: 4 July 2018; Accepted: 5 December 2018; Published: 14 December 2018

Edited by: Mohd Farooq Shaikh (Monash University, Malaysia)

Reviewed by: Narisorn Kitiyanant (Mahidol University, Thailand); Emilio Russo (University of Catanzaro, Italy); Kheng Seang Lim (University of Malaya, Malaysia)

https://doi.org/10.31117/neuroscirn.v1i3.16

 

Abstract: Gene mutation is one of the etiologies of early-onset epileptic encephalopathy (EOEE), an age-dependent seizure in infants, which leads to brain defects. Previous studies have shown that several genes namely, aristaless related homeobox (ARX), cyclin dependent kinase like 5 (CDKL5) and syntaxin binding protein 1 (STXBP1) are responsible for the pathophysiology of the syndrome. The study involved 20 EOEE patients and 60 control subjects, which aimed to investigate the clinical association of Malaysian EOEE subjects with 13 known pathogenic mutations in the genes of interest. In addition, the entire ARX exonic region was also sequenced for known and novel mutations. PCR specificity and efficiency were optimized using conventional PCR and High Resolution Melting Analysis (HRMA). All cases and approximately 10% of control amplicon samples were purified and subjected to DNA sequencing. All known mutations reported previously were not found in control subjects and Malaysian EOEE patients with 100% confirmation by sequencing results. Sequencing of ARX exonic regions of patient samples did not find any mutation in all exons. The preliminary study indicates that selected known pathogenic mutations of ARX, CDKL5 and STXBP1 are not associated with EOEE in Malaysian paediatric patients.

 

Keywords: Early-onset epileptic encephalopathy; ARX gene; CDKL5 gene; STXBP1 gene; mutation screening; pediatric epilepsy; high resolution melting analysis;

 

©2018 by Jaafar et al for use and distribution in accord with the Creative Commons Attribution (CC BY-NC 4.0) license (https://creativecommons.org/licenses/by-nc/4.0/), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original author and source are credited.

 

 

1. INTRODUCTION

Early-onset epileptic encephalopathy (EOEE) is an age-related, rare group of specific conditions characterized by an impaired cognitive, sensory and motor function caused by the abnormal inter-ictal (seizure-like) and electrical (electrographic) activity during brain maturation [1]. It may occur as syndromic cases observed in the first 3 months (neonates) with isolated tonic seizure accompanied by suppression-burst (Ohtahara syndrome) and sometimes, accompanied with myoclonia (early myoclonic epilepsy). At 6 to 12 months (infants), migrating focal discharge and mild seizure arise frequently with hypsarrhythmia (West syndrome) [2,3]. The incidence of Ohtahara syndrome was reported at ~0.3/10,000 live births, whereas 3-5/10,000 live births for West syndrome, and ~2.8/10,000 live births for Lennox Gastaut syndrome [1]. The epidemiologic information and research into the etiology of EOEE in Malaysia, however, is lacking due to the rarity of the disease. Therefore, a patient registry should be established to document EOEE cases in the country.

 

The genetic predisposition in EOEE could be monogenic (involving one gene) or polygenic (multiple genes). Many genes have been associated with EOEE patients. There are 3 commonest genes frequently found to be linked to EOEE; (1) aristaless related homeobox (ARX), (2) cyclin dependent kinase like 5 (CDKL5) and (3) syntaxin binding protein (STXBP1). ARX and CDKL5 are X-linked dominant and recessive genes, respectively, while STXBP1 is an autosomal dominant gene located at chromosome 9. The X-linked ARX and CDKL5 genes located at Xp21.3 and Xp22 loci have 5 and 24 exons, respectively. ARX encodes a transcription factor that is involved in axonal guidance, neuronal proliferation and differentiation [4] while CDKL5 is a protein kinase that regulate the catalytic activity and nuclear placement of other proteins in the brain [5]. STXBP1 gene on the other hand is located on chromosome 9q34.11 locus encompasses 19 (Isoform a) to 20 (Isoform b) exons that plays a role in synaptic vesicle docking and fusion in the brain [6].

 

Most of the EOEE cases reported were due to de novo mutation(s) and very few familial cases were reported to date [7]. Splice-site, nonsense, missense, deletion, insertion, frameshift, and duplication mutations have been reported in ARX (44), CDKL5 (53) and STXBP1 (28) [8-15]. Interestingly, recurrent causative mutations have been reported in patients exhibit similar clinical characteristics. We are interested in identifying these causative mutations (Table 1) and correlate with various clinical findings in Malaysian EOEE patients.

 

The type and the site of mutation implicated the severity and time of onset of EOEE.  In ARX mutation, Suri (2004) [16] suggested that the premature termination at 'homeodomain' and missense mutation in 'aristaless domain' affected patients with mental retardation and other forms of brain malformation while the expansion of first and second polyalanine domain affect those with brain non-malformation. In CDKL5 mutation, Bahi-buisson et al. (2008) [9] and Russo et al. (2009) [11] reported that patients affected with nonsense mutation have a milder phenotype than those with missense or splicing mutations and those in 'catalytic domain' is more severe than in 'C-terminal domain'.  The effect of specific type and site of mutation is not yet elucidated for STXBP1 since the studies are still expanding. Based on previous reports, no specific 'hotspot' has been proven to cause more severe effects in epileptic encephalopathy patients [17].

 

Our group is interested in SNPs within ARX, CDKL5 and STXBP1 gene that are clinically associated with EOEE located at the coding sequences region and causes amino acid change in the encoded protein. ARX gene, being one of the most reported causative genes for EOEE, were also fully sequenced to determine novel polymorphisms within the exons that are potentially associated with Malaysian EOEE subjects. We aimed to identify selected known mutations (Table 1) and correlate with EOEE patients in Malaysian cohort.

 

 

2. MATERIALS AND METHODS

2.1. Ethics approval, sampling method and recruitment of subjects

The study was approved by National Medical Research Register (NMRR), Ministry of Health (MOH) (NMRR-12-1159-13653) and Universiti Putra Malaysia (UPM) Ethics Committee (RUGS 04-04-11-1483RU). The study was carried out in accordance to Helsinki declaration. Information sheet were given to the patients before an informed consent was obtained from either one of the parents for cases. Control subjects (adults) could sign the consent form as all of them were 21 years old and above.

 

A total of 20 cases diagnosed with sporadic EOEE were recruited from Hospital Serdang, Hospital Kuala Lumpur, Hospital Penang, Hospital Raja Perempuan Zainab II, Kota Bharu, University Malaya Medical Centre while the controls were recruited from Universiti Putra Malaysia. The samples were analyzed in Medical Genetic Laboratory, Faculty of Medicine and Health Science, UPM. Diagnoses were based on clinical assessment by pediatric neurologists. Data collected includes demographic data, physical examination, EEG status, family history and prescribed medications. Key clinical inclusion criteria were: Age less than 7 years old, onset of first seizure at less than 12 months old, electrophysiological and clinical features of infantile spasm with hypsarrhythmia or Ohtahara syndrome/early myoclonic epileptic encephalopathy with burst suppression or malignant migrating partial epilepsy of infancy or Lennox-Gastaut syndrome with prior history of the above. On the other hand, control subjects must be older than 18 years with no medical complications and history of epilepsy. See Figure 1 for the flow of subjects' recruitment and list of inclusion and exclusion criteria.

 

2.2. Blood collection

Approximately 3 ml of peripheral blood was collected via venipuncture and transferred into ethylene-diaminetetraacetic acid (EDTA) tube. The blood sample was mixed soon after collection to avoid coagulation. The blood sample was packed and delivered on ice-packs to Medical Genetics Laboratory, UPM, within 24 hours for processing.

 

2.3. High-resolution melting analysis

Genomic DNA (gDNA) was extracted from the buffy coat using the QiaAmp DNA Blood Mini kit (Qiagen, USA) according to manufacturer's protocol. Eleven primer sets were designed using Primer3 program (http://www.bioinformatics.nl/) to flank selected SNPs (Table 1). Pre-analysis of polymerase chain reaction (PCR) and real-time PCR were performed prior to High-Resolution Melting (HRM) analysis. The HRM analysis was performed in 10 µl reaction volumes containing 30 ng/µl of genomic DNA, 0.7 µl of each 10µM primers, 5 µl of Type-It HRM-PCR kit (HotStarTaq Plus DNA Polymerase; EvaGreen Dye; optimized concentration of Q-solution; dNTPs; MgCl2; Qiagen, USA). Non-template controls were included in all run. The reactions were run on 5-plex HRM real-time PCR machine on Rotor Disc 72 mounted on Rotor-Gene™ 6000 (Qiagen, USA). PCR conditions involved a single pre-denaturation step of 95°C for 5 minutes followed by 45 cycles of 95°C for 10 seconds, 53-60°C (60°C for the SNP in ARX, 55°C for CDKL5 SNPs and 53°C STXBP1 SNPs) for 30 seconds and green channel of fluorescence acquisition (460 nm excitation; 510 nm detection) was carried out during the extension step. After cooling, HRM analysis was run by 0.1°C increment with 2 seconds hold and ramping from 65-95°C with a pre-melt condition of 90 seconds at the first step. The total reactions ended approximately in 2.5 h. The data obtained were analyzed using the Rotor-Gene 6000 Series Software v1.7 (Qiagen, USA).

 

 

https://www.neuroscirn.org/webaccess/vol1/no3/16_files/image002.png

 

Figure 1. Flow of subjects' recruitment based on approved inclusion/exclusion criteria.

 

 

The analysis was performed in three steps which includes normalization, curve overlaid, and variant clustering. Amplification plot was analyzed using comparative quantitation by assessing Ct value (threshold cycle), end-point fluorescence and amplification rate. Data outside the standard criteria were omitted due to late amplification that may produce variable results. Derivative melt curve of optimized assays was kept as single bimodal peak for all samples prior to genotyping.

 

In HRM analysis, the comparative quantitation, derivative melt-curve, melting graph and difference graph enables the discrimination of SNP variations in different samples. Based on the Qiagen Type-it HRM-PCR handbook (2009), comparative quantitation analysis is used to check on Ct value of "less than 30" and amplification rate of "more than 1.4" for a successful analysis.

 

 

Table 1: Targeted known single nucleotide mutation in ARX, CDKL5 and STXBP1 and their associated primer set used for high resolution melting analysis

 

Gene

dbSNP ID

Exon

Mutation

Protein change

Allele status on dbSNP

References

Primers (5'→3')

Amplicon size (bp)

ARX

N/A

1

c.81C>G

p.(Val27X)

Untested allele

[18]

F: CAGCAACCGCATTTTGCAC

R: CCAGCCATGAGCAATCAGT

138

CDKL5

rs 62653623

5

c.175C>T

p.(Arg59X)

Untested allele

[19,20]

F: TGGGATGTTTTCAGTGTTCT

R: ATGCTTCCTTCAACTCCACAAT

176

rs 62643608

5

c.183delT

p.(Met63fs)

Pathogenic

[21]

rs 62641235

5

c.215T>A/T>C

p.(Ile72Asn)/p.(Ile72Ile)/p.(Ile72Thr)

Pathogenic

[11,22,23]

F: AGCTTAAAATGCTTCGGACTCTC

R: TGCACATTGGCAATTAATGACT

129

rs 122460157

7

c.455G>T

p.(Cys152Phe)

Pathogenic

[19,24]

F: TGACACTCCAGATATAAAACCAGA

R: CATGTGACTCAAAAGAATGTTCC

207

rs 61749700

8

c.525A>T

p.(Arg175Ser)

Pathogenic

[11,25]

F: GCTATCTTTCAGGTTTTGCTCGT

R: ATCAGCAGATGTGGAAATGTCA

149

rs 61749704

8

c.539C>T

p.(Pro180Leu)

Pathogenic

[23]

rs 61750250

11

c.838_847del10

p.(Leu280Ala)

Pathogenic

[26]

F: TCTGCAATGACTGTGTATTTCTTT

R: AGAAGTCTCTGGGTTTGAAATGT

190

STXBP1

rs 121918320

5

c.251T>A

p.(Val84Asp)

Pathogenic

[27]

F: ACAGGTCCCATTTGGCTCTA

R: AATGCTAACCTGCCTGATGG

188

rs 121918318

7

c.539G>A

p.(Cys180Tyr)

Pathogenic

F: CCTTGGACTCTGCTGACTCTTT

R: CAGACTGGTGCACTGCCTTAC

163

rs 121918321

14

c.1162C>T

p.(Arg388Ter)

Pathogenic

F: GGAGCCAATGAGGTGTGTTT

R: CCACAGCCCTACCATTCTTC

178

rs 121918319

15

c.328T>G

p.(Met443Arg)

Pathogenic

F: TCACGGAGGAAAACCTGAAC

R: CAGTCAGAGCAGAAGCAGACA

179

rs 121918317

18

c.1631G>A

p.(Gly544Asp)

Pathogenic

F: CTATGGGCACTGGCATAAGAAC

R: ACCTATCAGCACCTCCCACTT

151

 

 

Genotypes of the unknown samples were auto-called by the software using standard option and displayed using two curves; normalized curve and difference curve. The normalized curve was generated based on the dissociation of the fluorescence dye from double-stranded DNA to form single-stranded DNA as the temperature increases. The difference curve measured the difference between selected samples with samples of known genotypes as baseline. Using a standard normalized region and confidence threshold set to a minimum of 90%, the normalize curve distinguished homozygote based on changes in shape and heterozygotes in temperature shifting on x-axis while the difference curve enhances the difference between selected samples as compared to the wild-type profile.

 

For validation, suspected positive mutant samples were purified (Intron Biotechnology, South Korea) and sent for DNA sequencing services. All cases and 10% of control samples in each HRM cluster of normalized curves were purified and sequenced. Trace files were analyzed, and sequence alignment was conducted using DNA Baser v3.5.4 software. Phred score value of 20 or more was used to define the quality of the sequencing result.

 

2.4. Sequencing of ARX exons

A total of 50 µl PCR reaction was prepared in 1.5 µl microcentrifuge tube containing 2.5 U Expand long template PCR mix (Roche), 1X Failsafe Premix J (Epicentre Technology), 50-100 ng/ul of DNA, 150 nM forward and reverse primer, and RNase-free water. The primers used to amplify all the five ARX exons were based on Strømme et al., 2002 (Table 2). Touchdown PCR were performed on all samples using the Mastercycler™ Gradient S (Eppendorf, Germany) with the following steps; 94°C for 5 minutes followed by 35 cycles of 94°C for 30 s, 65-60°C for 30 s and 68 °C for 2 min. A final step was carried out at 68°C for 7 min before the samples were held at 4oC until further analysis. PCR products were electrophoresed on 2.0% (w/v) agarose gel to examine the size of amplicons. Samples were purified and sequenced using the Sanger's method. Trace files were analyzed, and sequence alignment was conducted using DNA Baser v3.5.4 software. Phred score value of 20 or more was used to define the quality of the sequence.

 

 

Table 2: Primers used for the amplification of ARX exons

 

Exon

Primer (5'→3')

Amplicon length

(bp)

Amplicon Tm

(°C)

1

F: GCTCACTACACTTGTTACCGC

R: AATTGACAATT CCAGGCCACTG

520

63

2

F: ACGCCTGGGCCTAGGCACTG

R: CTCGGTGCCGGTGCCACCAC

584

62

2

F: GCAAGTCGTACCGCGAGAACG

R: TGCGCTCTCTGCCGCTGCGA

602

62

3

F: CTGCCATAGAGGAGGAAATAG

R: GGTTTTGTGAAGGGGATCTCAC

239

60

4

F: GACGCGTCCGAAAACAACCTGAG

R: CCCCAGCCTCTGTGTGTATG

551

60

5

F: ACAGCTCCCGAGGCCATGAC

R: GAGTGGTGCTGAGTGAGGTGA

347

60

 

 

 

 

3. RESULTS

The screening involves 20 cases and 60 control samples. Patient age group ranged from 25-day to two years old. Their samples were provided by Hospital Serdang (n=7), Hospital Raja Perempuan Zainab II (n=6), Hospital Kuala Lumpur (n=1), Hospital Pulau Pinang (n=2), Women and Children Hospital Sabah (n=3) and University Malaya Medical Centre (n=1). Approximately 45% of the patients were above 6 months to 2 years old, 30% below 2 months old and 25% between 3 to 6 months old.

 

Among 20 cases, 55% of the patients were male while 45% female (Table 3). They were presented with spasm (50%), generalized tonic clonic seizure (GTCS) (10%) and some were accompanied with myoclonic (5%). Collectively, 15% had spasm accompanied with focal and myoclonic seizures while 5% had focal accompanied with myoclonic seizures. Based on the outcome of syndrome, 55% of cases is West syndrome, 20% Ohtahara syndrome, 10% migrating partial epilepsy of infancy (MPEI), and 15% early myoclonic epilepsy (EME). The results were in concordance with electroencephalogram (EEG) reports showing 50% of cases had hypsarrhythmia which was a typical EEG profile of patients with West syndrome, 20% burst-suppression of Ohtahara syndrome patients and 30% had epileptiform discharge. Other than age, gender, seizure type and EEG type, family history was also recorded. Among the cases, 15% subjects were positive while 85% negative of epileptic family background. Other findings on magnetic resonance imaging, metabolic profile and prescribed treatment are listed in Table 3. Gradient PCR optimization (Figure 2), HRM analysis (Figure 3) and DNA sequencing of all cases and selected control samples (Figure 4) did not find any of the selected causative mutations in ARX, CDKL5 and STXBP1 genes in all samples. In addition, direct sequencing of all ARX exons (data not shown) did not reveal any polymorphisms or mutations in both cases and control samples. Our preliminary results show that the reported causative mutations do not exist in the studied pilot group of Malaysian EOEE patients.

 

 

Table 3: Clinical diagnosis and EOEE patients

 

Gender

Agea

Seizure typeb

Epilepsy syndromec

Development

Family historyd

Physical examination

EEG features

MRI findings

Metabolic profilese

Medication

(current and past)

F

8m

Spasm

West

Normal

Negative

Normal

Hypsarrhythmia

Normal

Normal

Epilim; Vigabatrin

F

1m

GTCS and spasm

MPEI

Normal

Negative

Normal

Hypsarrhythmia

Normal

Normal

Clonazepam

F

4m

Spasm

West

Delayed

Negative

Normal

Multifocal epileptiform discharge

Non-specific white matter changes

Normal

Valproate; Keppra; Clobazam; Ketogenic diet

F

1w

Spasm, focal and myoclonic

Ohtahara

Delayed

Negative

Abnormal (autistic)

Burst suppression

Not available

Not available

Prednisolone; Nitrazepam

F

1w

GTCS

West

Delayed

Negative

Normal

Hypsarrhythmia

Subarachnoid space & hypertrophic of arachnoid membrane, Left-frontal region, mild cerebral atrophy

Not available

Clobazam

F

2m

Spasm

West

Normal

Negative

Normal

Burst-suppression

Not available

Not available

Phenobarbitone; Clonazepam

F

2m

Focal and spasm

EME

Delayed

Positive

Normal

Multifocal epileptiform discharge

Normal

Normal

Levetiracetam; Clobazam; Topiramate

F

4m

Spasm, focal and myoclonic

Ohtahara

Delayed

Negative

Abnormal (hypotonia)

Multifocal epileptiform discharge

Prominent

Not available

Prednisolone; Pyridoxine; Nitrazepam

F

1m

Spasm

West

Delayed

Negative

Normal

Hypsarrhythmia

Mild thinning of corpus collosum

Normal

Vigabatrin

M

1m

Focal

West

Normal

Negative

Normal

Hypsarrhythmia

Normal

Normal

Prednisolone

M

1m

Spasm

West

Normal

Negative

Normal

Hypsarrhythmia

Normal

Normal

Prednisolone

M

2m

Spasm

EME

Delayed

Negative

Abnormal (autistic)

Hypsarrhythmia

Normal

Normal

Sodium valproate

M

1m

Spasm

EME

Delayed

Negative

Abnormal (generalised hypotonia)

Hypsarrhythmia

Delayed myelination

Normal

Pyridoxine; Sodium Valproate; Nitrazepam

M

2m

Tonic

Ohtahara

Delayed

Negative

Abnormal (quadriplegia)

Burst-suppression

Normal

Normal

Vigabatrin; Phenobarbitone

M

8m

GTCS

West

Delayed

Negative

Normal

Multifocal epileptiform discharge

Normal

Normal

Clonazepam

M

5m

Spasm

West

Delayed

Negative

Normal

Hypsarrhythmia

Normal

Normal

Vigabatrin; Ketogenic diet

M

2m

Focal

MPEI

Delayed

Negative

Abnormal (hypotonia)

Multifocal epileptiform discharge

Not available

Not available

Levetiracetam; Vigabatrin; Ketogenic diet; Clonazepam; Prednisolone

M

2m

Spasm, focal and myoclonic

Ohtahara

Delayed

Positive

Abnormal (microcephaly)

Burst-suppression

Absent corpus collosum, Cerebellar hypoplasia, Atrophy

Normal

Keppra; Topiramate; Carbamazepine

M

6m

Spasm

West

Normal

Negative

Normal

Hypsarrhythmia

Normal

Normal

Prednisolone

M

5m

Spasm

West

Delayed

Negative

Normal

Multifocal epileptiform discharge

Normal

Normal

Prednisolone; Vigabatrin

a refers to age at onset.  "w" denotes week(s), "m" denotes month(s).

b "GTCS" denotes generalized tonic clonic seizure.

c "MPEI" denotes migrating partial epilepsy of infancy, "EME" denotes early myoclonic encephalopathy.

d Family history was traced up to 3rd degree relatives.

e Metabolic profiles interpretation was based on blood and urine tests for biochemical profiles.


 

https://www.neuroscirn.org/webaccess/vol1/no3/16_files/image003.png

 

Figure 2. Gradient PCR gel electrophoresis for (A) ARX c.81C>G (138 bp). PCR was performed at different temperature ranging from 59.0°C to 62.3°C (L=1 kb ladder, 1=59.0°C, 2=60.1°C, 3=61.2°C, 4=62.3°C), (B) CDKL5 (1) c.175C>T, c.183delT, (2) c.215T>A/C, (3) c.455G>T (4) c.525A>T, c.539C>T, (C) STXBP1 c.1162C>T, (D) c.1631G>A, c.539G>A, (E) c.328T>G and c.251T>A (L=1 kb ladder, 1=44.1°C, 2=46.2°C, 3=47.8°C, 4=49.6°C, 5=51.5°C, 6=53.4°C, 7=55.2°C, 8=57.9°C). (F) Touch-down PCR amplification of ARX exons ranging from 65°C to 60°C (L=1 kb ladder, 1=exon 1, 2=exon 2P1, 3=exon 2P2, 4=failed amplification for exon 3, 5=exon 4, 6=exon 5 and 7=exon 3).

 

 

 

https://www.neuroscirn.org/webaccess/vol1/no3/16_files/image004.png

 

Figure 3. High-Resolution Melting analysis of ARX (A & B), CDKL5 (C & D) and STXBP1 (E & F) selected causative mutations/SNPs based on the (A, C & E) derivative melting and (B, D & F) normalized curves. The derivative melting curves contain a pair of data points for temperature and fluorescence intensity that denote the dissociation-characteristics of double-stranded DNA. The normalized curve shows the intensity between 0-100% after uniformly normalized all the samples against their pre-melt (initial fluorescence) and post-melt (final fluorescence) signals.

 

 

https://www.neuroscirn.org/webaccess/vol1/no3/16_files/image006.png

 

Figure 4. DNA sequencing of (A) ARX c.81C>G, (B) CDKL5 c.175C>T, CDKL5 c.183delT, (C) CDKL5 c.215T>A/C, (D) CDKL5 c.455G>T, (E) CDKL5 c.525A>T, CDKL5 c.539C>T, (F) CDKL5 c.838_847del1, (G) STXBP1 c.1631G>A, (H) STXBP1 c.539G>A, (I) STXBP1 c.328T>G, (J) STXBP1 c.251T>A and (K) STXBP1 c.1162C>T. Red box indicates the targeted SNPs at the region of interest.

 

 

 

4. DISCUSSION

The pilot study was limited by the small sample size due to the rareness of the disease in Malaysia [28]. Furthermore, a comprehensive screening is required to cover complete coding region whilst including mutation in the promoter and other regulatory sequences. The negative results did not preclude possible epigenetic contributions that may alter the expression profile of these genes leading to the clinical observations.

 

The absence of previously reported causative mutations in idiopathic Malaysian EOEE patients may possibly due to the heterogeneity of the disease manifested with a spectrum of clinical presentation. Fullston and colleagues (2010) [18] reported that ARX c.81C>G was found in two male cousins, one with West syndrome and another with Ohtahara. The first one was presented with focal seizure at four weeks old, infantile spasm at four months, delayed in all areas of brain development at 5-year-old, refractory to anticonvulsant therapy, myoclonic, and occasional tonic clonic. The cousin had tonic clonic, myoclonic on day five, Ohtahara syndrome on three weeks old, hypotonia at five months old. However, the body development was normal. The clinical presentation was different in Malaysian patients suggesting c.81C>G causes severe clinical manifestation that is specific in nature that was due to the formation of truncated protein [18]. Despite being one of the most reported causative genes for EOEE and additional exonic sequencing, no ARX mutations or polymorphisms were detected in our samples.

 

Most of the EOEE patients with CDKL5 causative mutations were reported as having intellectual disability, which was absent in all Malaysian EOEE patients recruited in this study. The difference in clinical manifestation may be affected by different causative mutations found to be associated with the wide spectrum of clinical findings that presented at different time of onset [9]. For example, c.175C>T was described by Archer et. al (2006) [19] and Castrén et al. (2006) [13] in a 6-year old patient in two separate studies. The same mutation was again found by Bahi-Buisson et al. (2008) [9] in a 21-year old patient. Clinical presentation described on two patients who were unable to sit while another was able with aid. They had autistic features, hand stereotypies and deceleration of head growth. The seizure started at the age of four weeks and stop for the first reported patient while the second patient had severe epilepsy onset at twelve hours after born which develop into infantile spasm. When comparing with Malaysian EOEE patients, they are developmentally normal. Although two subjects were reported as autistic, no such mutation was found in both samples. Saitsu et al. (2008) [2] described on five patients with c.1631G>A, c.539G>A, c.328T>G, c.251T>A and c.1162C>T have age of onset at less than three months old presented with Ohtahara syndrome with suppression-burst pattern on EEG. They had poor visual attention, no head control, non-verbal, weak eye pursuit and late walking ability and neurological examination displayed profound mental retardation with spastic quadriplegia, and diplegia. These causative mutations, however, were absent in four Malaysian Ohtahara patients whom we recruited in the study. Developmental and neurological examinations were normal in the recruited patients suggesting the causative mutations are likely to be associated with more severe clinical manifestations.

 

Sampaio et al. (2015) [29] suggested the need to screen STXBP1 gene when both ARX in male and CDKL5 in female were not at all associated with the disease. Subsequently, all samples in this study were subjected to STXBP1 causative mutations screening. Moreover, these SNPs that have been found in Ohtahara syndrome patients were also screened in West syndrome, MPEI and EME patients to increase the targeted pool. However, the results were all negatives. One of the limitations of this study was the low sample size.

 

The cases are very rare and frequently presented with complex overlapping electro-clinical findings. Other than that, our screening only focusses on thirteen reported causative mutations in three commonest genes. Other novel genetic markers pertaining to Malaysian subjects may have been overlooked. Common allele in other populations may be rare in Malaysian population. Unlike Caucasian, EOEE is considered rare with very low prevalence in Malaysia [28].

 

5. CONCLUSIONS

In conclusion, thirteen ARX, CDKL5 and STXBP1 causative mutations that were reported to be associated with EOEE patients were absent in both cases and control Malaysian subjects. No novel mutation was found in ARX exons in all the EOEE cases. Nonetheless, HRMA was proven as effective and efficient genetic screening method to serve as a routine genetic screening in a clinical setting due to its robustness and accuracy during the screening process. This is the first targeted genetic screening of EOEE subjects in Malaysia. In future, it is recommended to increase the sample size and sub-classifying patients according to different clinical characteristics or EEG profiles for genetic comparison. Unbiased approaches such as whole genome sequencing and SNP array analysis should be adopted to identify novel genetic markers for the disease.

 

 

Acknowledgements: This work was supported in part by funding from the UPM Research University Grant Scheme and UPM Geran Putra IPS (UPM/700/2/1/GP-IPS/2013/9399833) awarded to FA and KHL, respectively. We thank the staff of the hospitals involved for their invaluable assistance. AJ was the recipient of the Malaysian Ministry of Higher Education MyMaster scholarship and UPM Graduate Research Fellowship.

 

Author Contributions: Conception and design: FA, KHL. Drafting of the article: AJ, FA, KHL. Final approval of the article: AJ, FA, KHL. Provision of study materials or patients: AJ, FA. Administrative, technical, or logistic support: AJ, FA, KHL. Collection and assembly of data: AJ, FA, KHL.

 

Conflicts of Interest: The authors declare no conflict of interest.

 

References

1.      Panayiotopoulos CP. Neonatal epileptic seizures and neonatal epileptic syndromes. In: A Clinical Guide to Epileptic Syndromes and their Treatment. London: Springer London; 2010. pp. 237-258. https://doi.org/10.1007/978-1-84628-644-5_8

2.      Saitsu H, Kato M, Mizuguchi T, Hamada K, Osaka H, Tohyama J, et al. De novo mutations in the gene encoding STXBP1 (MUNC18-1) cause early infantile epileptic encephalopathy. Nat Genet. 2008;40(6):782-788. https://doi.org/10.1038/ng.150

3.      Ohtahara S, Yamatogi Y. Ohtahara syndrome: with special reference to its developmental aspects for differentiating from early myoclonic encephalopathy. Epilepsy Res. 2006;70 Suppl 1:S58-S67. https://doi.org/10.1016/j.eplepsyres.2005.11.021

4.      Friocourt G, Poirier K, Rakić S, Parnavelas JG, Chelly J. The role of ARX in cortical development. Eur J Neurosci. 2006;23(4):869-876. https://doi.org/10.1111/j.1460-9568.2006.04629.x

5.      Bahi-Buisson N, Bienvenu T. CDKL5-Related Disorders: From Clinical Description to Molecular Genetics. Mol Syndromol. 2012;2(3-5):137-152. https://doi.org/10.1159/000331333

6.      Swanson DA, Steel JM, Valle D. Identification and Characterization of the Human Ortholog of Rat STXBP1, a Protein Implicated in Vesicle Trafficking and Neurotransmitter Release. Genomics. 1998;48(3):373-376. https://doi.org/10.1006/geno.1997.5202

7.      Kamien BA, Cardamone M, Lawson JA, Sachdev R. A genetic diagnostic approach to infantile epileptic encephalopathies. J Clin Neurosci. 2012;19(7):934-941. https://doi.org/10.1016/j.jocn.2012.01.017

8.      Buoni S, Zannolli R, Colamaria V, Macucci F, di Bartolo RM, Corbini L, et al. Myoclonic encephalopathy in the CDKL5 gene mutation. Clin Neurophysiol. 2006;117(1):223-227. https://doi.org/10.1016/j.clinph.2005.09.008

9.      Bahi-Buisson N, Nectoux J, Rosas-Vargas H, Milh M, Boddaert N, Girard B, et al. Key clinical features to identify girls with CDKL5 mutations. Brain. 2008;131(Pt 10):2647-2661. https://doi.org/10.1093/brain/awn197

10.   Rosas-Vargas H, Bahi-Buisson N, Philippe C, Nectoux J, Girard B, N'Guyen Morel MA, et al. Impairment of CDKL5 nuclear localisation as a cause for severe infantile encephalopathy. J Med Genet. 2008;45(3):172-178. https://doi.org/10.1136/jmg.2007.053504

11.   Russo S, Marchi M, Cogliati F, Bonati MT, Pintaudi M, Veneselli E, et al. Novel mutations in the CDKL5 gene, predicted effects and associated phenotypes. Neurogenetics. 2009;10(3):241-250. https://doi.org/10.1007/s10048-009-0177-1

12.   Liang J-S, Shimojima K, Takayama R, Natsume J, Shichiji M, Hirasawa K, et al. CDKL5 alterations lead to early epileptic encephalopathy in both genders. Epilepsia. 2011;52(10):1835-1842. https://doi.org/10.1111/j.1528-1167.2011.03174.x

13.   Castrén M, Gaily E, Tengström C, Lähdetie J, Archer H, Ala-Mello S. Epilepsy caused by CDKL5 mutations. Eur J Paediatr Neurol. 2011;15(1):65-69. https://doi.org/10.1016/j.ejpn.2010.04.005

14.   Intusoma U, Hayeeduereh F, Plong-On O, Sripo T, Vasiknanonte P, Janjindamai S, et al. Mutation screening of the CDKL5 gene in cryptogenic infantile intractable epilepsy and review of clinical sensitivity. Eur J Paediatr Neurol. 2011;15(5):432-438. https://doi.org/10.1016/j.ejpn.2011.01.005

15.   Rademacher N, Hambrock M, Fischer U, Moser B, Ceulemans B, Lieb W, et al. Identification of a novel CDKL5 exon and pathogenic mutations in patients with severe mental retardation, early-onset seizures and Rett-like features. Neurogenetics. 2011;12(2):165-167. https://doi.org/10.1007/s10048-011-0277-6

16.   Suri M. The phenotypic spectrum of ARX mutations. Dev Med Child Neurol. 2005;47(2):133-137. https://doi.org/10.1111/j.1469-8749.2005.tb01102.x

17.   Mignot C, Moutard M-L, Trouillard O, Gourfinkel-An I, Jacquette A, Arveiler B, et al. STXBP1-related encephalopathy presenting as infantile spasms and generalized tremor in three patients. Epilepsia. 2011;52(10):1820-1827. https://doi.org/10.1111/j.1528-1167.2011.03163.x

18.   Fullston T, Brueton L, Willis T, Philip S, MacPherson L, Finnis M, et al. Ohtahara syndrome in a family with an ARX protein truncation mutation (c.81C>G/p.Y27X). Eur J Hum Genet. 2010;18(2):157-162. https://doi.org/10.1038/ejhg.2009.139

19.   Archer HL, Evans J, Edwards S, Colley J, Newbury-Ecob R, O'Callaghan F, et al. CDKL5 mutations cause infantile spasms, early onset seizures, and severe mental retardation in female patients. J Med Genet. 2006;43(9):729-734. https://doi.org/10.1136/jmg.2006.041467

20.   Ricciardi S, Kilstrup-Nielsen C, Bienvenu T, Jacquette A, Landsberger N, Broccoli V. CDKL5 influences RNA splicing activity by its association to the nuclear speckle molecular machinery. Hum Mol Genet. 2009;18(23):4590-4602. https://doi.org/10.1093/hmg/ddp426

21.   Weaving LS, Christodoulou J, Williamson SL, Friend KL, McKenzie OLD, Archer H, et al. Mutations of CDKL5 cause a severe neurodevelopmental disorder with infantile spasms and mental retardation. Am J Hum Genet. 2004;75(6):1079-1093. https://doi.org/10.1086/426462

22.   Evans JC, Archer HL, Colley JP, Ravn K, Nielsen JB, Kerr A, et al. Early onset seizures and Rett-like features associated with mutations in CDKL5. Eur J Hum Genet. 2005;13(10):1113-1120. https://doi.org/10.1038/sj.ejhg.5201451

23.   Saletti V, Canafoglia L, Cambiaso P, Russo S, Marchi M, Riva D. A CDKL5 mutated child with precocious puberty. Am J Med Genet A. 2009;149A(5):1046-1051. https://doi.org/10.1002/ajmg.a.32806

24.   Tao J, Van Esch H, Hagedorn-Greiwe M, Hoffmann K, Moser B, Raynaud M, et al. Mutations in the X-linked cyclin-dependent kinase-like 5 (CDKL5/STK9) gene are associated with severe neurodevelopmental retardation. Am J Hum Genet. 2004;75(6):1149-1154. https://doi.org/10.1086/426460

25.   Nemos C, Lambert L, Giuliano F, Doray B, Roubertie A, Goldenberg A, et al. Mutational spectrum of CDKL5 in early-onset encephalopathies: a study of a large collection of French patients and review of the literature. Clin Genet. 2009;76(4):357-371. https://doi.org/10.1111/j.1399-0004.2009.01194.x

26.   Mari F, Azimonti S, Bertani I, Bolognese F, Colombo E, Caselli R, et al. CDKL5 belongs to the same molecular pathway of MeCP2 and it is responsible for the early-onset seizure variant of Rett syndrome. Hum Mol Genet. 2005;14(14):1935-1946. https://doi.org/10.1093/hmg/ddi198

27.   Saitsu H, Kato M, Okada I, Orii KE, Higuchi T, Hoshino H, et al. STXBP1 mutations in early infantile epileptic encephalopathy with suppression-burst pattern. Epilepsia. 2010;51(12):2397-2405. https://doi.org/10.1111/j.1528-1167.2010.02728.x

28.   Thambyayah M. Early epileptic encephalopathies including West syndrome: a 3-year retrospective study from Klang Hospital, Malaysia. Brain Dev. 2001;23(7):603-604. https://doi.org/10.1016/S0387-7604(01)00293-5

29.   Sampaio M, Rocha R, Biskup S, Leão M. Novel STXBP1 mutations in 2 patients with early infantile epileptic encephalopathy. J Child Neurol. 2015;30(5):622-624. https://doi.org/10.1177/0883073813479169